evelyn608429 evelyn608429

23-09-2021
Mathematics

contestada

15D. Solve for n then y. 5t X Х - d 5n - 10 y 2n - 7 ㅋ

Respuesta :

25-09-2021

Answer:

14

Step-by-step explanation:

d

Answer Link

Otras preguntas

WILL GIVE BRAINIEST HELP FAST. The Treaty of Guadalupe Hidalgo of 1848 A) forced President Polk to surrender to Mexico. B) negotiated the end of the Mexican Ame

157.5 in a simplified fraction

Please help!!!!!!!!!!!

Dr. McManus works in the prison system as a psychologist. He wants to show that his new clinical treatment makes prisoners less likely to commit a crime when th

Reread lines 18–23. What is Kennedy referring to when he says he “had a member of my family killed . . .”?"

What implicit message could most clearly be inferred from the National Geographic video? O A. Unwarranted fear of vaccination is causing flu deaths. O B. It is

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

Annabelle measured and recorded the amount of rainfall for 9 days in a row. Her results are shown below. 3/10in., 1/5in.,1/10in., 3/10in., 2/5in., 1/5in., 1/5in

Plz help,I don’t understand.

The rise of global trade and the Enlightenment created a consumer base for popular culture, which often took the form of sensational pamphlets, news sheets, and